MYCT1-myc target 1 Gene View larger

MYCT1-myc target 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYCT1-myc target 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MYCT1-myc target 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022556
Product type: DNA & cDNA
Ncbi symbol: MYCT1
Origin species: Human
Product name: MYCT1-myc target 1 Gene
Size: 2ug
Accessions: BC022556
Gene id: 80177
Gene description: myc target 1
Synonyms: myc target protein 1; myc target in myeloid cells 1; myc target in myeloid cells protein 1; myc target 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctaataacacaacaagtttagggagtccatggccagaaaacttttgggaggaccttatcatgtccttcactgtatccatggcaatcgggctggtacttggaggatttatttgggctgtgttcatttgtctgtctcgaagaagaagagccagtgctcccatctcacagtggagttcaagcaggagatctaggtcttcttacacccacggcctcaacagaactggattttacggccacagtggctgtgaacgtcgaagcaacctcagcctggccagtctcaccttccagcgacaagcttccctggaacaagcaaattcctttccaagaaaatcaagtttcagagcttctactttccatccctttctgcaatgtccaccacttcctgtggaaactgagagtcagctggtgactctcccttcttccaatatctctcccaccatcagcacttcccacagtctgagccgtcctgactactggtccagtaacagtcttcgagtgggcctttcaacaccgcccccacctgcctatgagtccatcatcaaggcattcccagattcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proenkephalin
- CD84 molecule
- CD86 molecule
- cathepsin L1

Buy MYCT1-myc target 1 Gene now

Add to cart