FMNL2-formin-like 2 Gene View larger

FMNL2-formin-like 2 Gene

PTXBC036492

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FMNL2-formin-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FMNL2-formin-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036492
Product type: DNA & cDNA
Ncbi symbol: FMNL2
Origin species: Human
Product name: FMNL2-formin-like 2 Gene
Size: 2ug
Accessions: BC036492
Gene id: 114793
Gene description: formin-like 2
Synonyms: FHOD2; formin-like protein 2; formin homology 2 domain containing 2; formin homology 2 domain-containing protein 2; formin like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacttgaccaagagagagtacaccatgcatgaccataacacgctgctgaaggagttcatcctcaacaatgaggggaagctgaagaagctgcaggatgatgccaagatcgcacaggatgcctttgatgatgttgtgaagtattttggagaaaaccccaagacaacaccaccctctgtcttctttcctgtctttgtccggtttgtgaaagcatataagcaagcagaagaggaaaatgagctgaggaaaaagcaggaacaagctctcatggaaaaactcctagagcaagaagctctgatggagcagcaggatccaaagtctccttctcataaatcaaagaggcagcagcaagagttaattgcagaattaagaagacgacaagttaaagataacagacatgtatatgagggaaaagatggtgccattgaagatattatcacagccttaaagaagaataatatcactaaatttccaaatgttcactcgagggtaaggatttcttctagcacaccggtggtggaggatacacagagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interleukin 11
- transgelin 2
- CXXC finger 5
- mohawk homeobox

Buy FMNL2-formin-like 2 Gene now

Add to cart