CAV1-caveolin 1, caveolae protein, 22kDa Gene View larger

CAV1-caveolin 1, caveolae protein, 22kDa Gene

PTXBC009685

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CAV1-caveolin 1, caveolae protein, 22kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CAV1-caveolin 1, caveolae protein, 22kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009685
Product type: DNA & cDNA
Ncbi symbol: CAV1
Origin species: Human
Product name: CAV1-caveolin 1, caveolae protein, 22kDa Gene
Size: 2ug
Accessions: BC009685
Gene id: 857
Gene description: caveolin 1, caveolae protein, 22kDa
Synonyms: BSCL3; CGL3; LCCNS; MSTP085; PPH3; VIP21; caveolin 1, caveolae protein, 22kDa; cell growth-inhibiting protein 32; caveolin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgggggcaaatacgtagactcggagggacatctctacaccgttcccatccgggaacagggcaacatctacaagcccaacaacaaggccatggcagacgagctgagcgagaagcaagtgtacgacgcgcacaccaaggagatcgacctggtcaaccgcgaccctaaacacctcaacgatgacgtggtcaagattgactttgaagatgtgattgcagaaccagaagggacacacagttttgacggcatttggaaggccagcttcaccaccttcactgtgacgaaatactggttttaccgcttgctgtctgccctctttggcatcccgatggcactcatctggggcatttacttcgccattctctctttcctgcacatctgggcagttgtaccatgcattaagagcttcctgattgagattcagtgcatcagccgtgtctattccatctacgtccacaccgtctgtgacccactctttgaagctgttgggaaaatattcagcaatgtccgcatcaacttgcagaaagaaatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GC-rich promoter binding protein 1
- methyl-CpG binding domain protein 5
- phosphoglycerate mutase 2 (muscle)
- gap junction protein, beta 6, 30kDa

Buy CAV1-caveolin 1, caveolae protein, 22kDa Gene now

Add to cart