ZNF580-zinc finger protein 580 Gene View larger

ZNF580-zinc finger protein 580 Gene

PTXBC017698

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF580-zinc finger protein 580 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF580-zinc finger protein 580 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017698
Product type: DNA & cDNA
Ncbi symbol: ZNF580
Origin species: Human
Product name: ZNF580-zinc finger protein 580 Gene
Size: 2ug
Accessions: BC017698
Gene id: 51157
Gene description: zinc finger protein 580
Synonyms: zinc finger protein 580; LDL-induced EC protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctgctgccgccgcggccaccccaccctcggtcctcctctccggaggccatggacccaccgccccccaaggctccccctttccccaaggcggaaggcccctcctccactccttcctcggcggcggggccccgacccccgcggctgggccgccacctcctcatcgacgccaatggggtcccctacacatacacggtgcagctggaggaggagccccggggcccgccccagcgcgaggcgcccccaggagagcccggccctcgcaagggctacagctgcccggagtgcgcccgtgtctttgccagccctctgcggctgcagagccaccgcgtgtcgcactcggacctcaagcccttcacgtgcggcgcctgcggcaaggccttcaagcgctccagccacctgtcgcggcatcgcgccacgcaccgcgcccgcgccgggccgccgcacacctgcccgctctgtccacgccgcttccaggacgccgcggagctggcgcagcacgtgcgcctccactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 747
- zinc finger protein 581
- zinc finger protein 581
- HCLS1 binding protein 3

Buy ZNF580-zinc finger protein 580 Gene now

Add to cart