NME3-non-metastatic cells 3, protein expressed in Gene View larger

NME3-non-metastatic cells 3, protein expressed in Gene

PTXBC000250

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NME3-non-metastatic cells 3, protein expressed in Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NME3-non-metastatic cells 3, protein expressed in Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000250
Product type: DNA & cDNA
Ncbi symbol: NME3
Origin species: Human
Product name: NME3-non-metastatic cells 3, protein expressed in Gene
Size: 2ug
Accessions: BC000250
Gene id: 4832
Gene description: non-metastatic cells 3, protein expressed in
Synonyms: DR-nm23; NDPK-C; NDPKC; NM23-H3; NM23H3; c371H6.2; nucleoside diphosphate kinase 3; NDK 3; NDP kinase 3; NDP kinase C; non-metastatic cells 3, protein expressed in; nucleoside diphosphate kinase C; NME/NM23 nucleoside diphosphate kinase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatctgcctggtgctgaccatcttcgctaacctcttccccgcggcctgcaccggcgcacacgaacgcaccttcctggccgtgaagccggacggcgtgcagcggcggctggtgggcgagattgtgcggcgcttcgagaggaagggcttcaagttggtggcgctgaagctggtgcaggcctccgaggagctgctgcgtgagcactacgccgagctgcgtgaacgcccgttctacggccgccttgtcaagtatatggcctccgggccggtggtggccatggtttggcaggggctggacgtggtgcgcacctcgcgggcgctcatcggagccacgaacccggccgacgccccgcccggcaccatccgcggggatttctgcatcgaggttggcaagaacctgattcacggcagcgactcggtggagagtgcccgccgcgagatcgctctctggttccgcgcagacgagctcctctgctgggaggacagcgctgggcactggctgtatgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - insulin-like growth factor 2 (somatomedin A)
- ubiquitin-conjugating enzyme E2T (putative)
- Sjogren syndrome/scleroderma autoantigen 1
- dual specificity phosphatase 26 (putative)

Buy NME3-non-metastatic cells 3, protein expressed in Gene now

Add to cart