Login to display prices
Login to display prices
CHIC2-cysteine-rich hydrophobic domain 2 Gene View larger

CHIC2-cysteine-rich hydrophobic domain 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHIC2-cysteine-rich hydrophobic domain 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHIC2-cysteine-rich hydrophobic domain 2 Gene

Proteogenix catalog: PTXBC034691
Ncbi symbol: CHIC2
Product name: CHIC2-cysteine-rich hydrophobic domain 2 Gene
Size: 2ug
Accessions: BC034691
Gene id: 26511
Gene description: cysteine-rich hydrophobic domain 2
Synonyms: BTL; cysteine-rich hydrophobic domain-containing protein 2; BRX-like translocated in leukemia; cystein-rich hydrophobic domain 2; cysteine-rich hydrophobic domain 2 protein; cysteine rich hydrophobic domain 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggatttcgacgaaatctatgaggaagaggaggacgaggagcgggccctggaggagcagctgctcaagtactcgccggacccggtggtcgtccgcggctccggtcacgtcaccgtatttggactgagcaacaaatttgaatctgaattcccttcttcattaactggaaaagtagctcctgaagaatttaaagccagcatcaacagagttaacagttgtcttaagaagaaccttcctgttaatgtacgttggctactttgtggctgcctttgttgctgctgcacattaggttgcagtatgtggccagttatttgcctcagtaaaagaacacgaagatcgattgagaagttattagaatgggaaaacaataggttataccacaagctgtgcttgcattggagactgagcaaaaggaaatgtgaaacgaataacatgatggaatatgtcatcctcatagaatttttaccaaagacaccgatttttcgaccagattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice