Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CHIC2-cysteine-rich hydrophobic domain 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHIC2-cysteine-rich hydrophobic domain 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034691 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHIC2 |
| Origin species: | Human |
| Product name: | CHIC2-cysteine-rich hydrophobic domain 2 Gene |
| Size: | 2ug |
| Accessions: | BC034691 |
| Gene id: | 26511 |
| Gene description: | cysteine-rich hydrophobic domain 2 |
| Synonyms: | BTL; cysteine-rich hydrophobic domain-containing protein 2; BRX-like translocated in leukemia; cystein-rich hydrophobic domain 2; cysteine-rich hydrophobic domain 2 protein; cysteine rich hydrophobic domain 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggatttcgacgaaatctatgaggaagaggaggacgaggagcgggccctggaggagcagctgctcaagtactcgccggacccggtggtcgtccgcggctccggtcacgtcaccgtatttggactgagcaacaaatttgaatctgaattcccttcttcattaactggaaaagtagctcctgaagaatttaaagccagcatcaacagagttaacagttgtcttaagaagaaccttcctgttaatgtacgttggctactttgtggctgcctttgttgctgctgcacattaggttgcagtatgtggccagttatttgcctcagtaaaagaacacgaagatcgattgagaagttattagaatgggaaaacaataggttataccacaagctgtgcttgcattggagactgagcaaaaggaaatgtgaaacgaataacatgatggaatatgtcatcctcatagaatttttaccaaagacaccgatttttcgaccagattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - caveolin 1, caveolae protein, 22kDa - GC-rich promoter binding protein 1 - methyl-CpG binding domain protein 5 - phosphoglycerate mutase 2 (muscle) |