PMCH-pro-melanin-concentrating hormone Gene View larger

PMCH-pro-melanin-concentrating hormone Gene

PTXBC018048

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PMCH-pro-melanin-concentrating hormone Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PMCH-pro-melanin-concentrating hormone Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018048
Product type: DNA & cDNA
Ncbi symbol: PMCH
Origin species: Human
Product name: PMCH-pro-melanin-concentrating hormone Gene
Size: 2ug
Accessions: BC018048
Gene id: 5367
Gene description: pro-melanin-concentrating hormone
Synonyms: MCH; ppMCH; pro-MCH; prepro-MCH; prepro-melanin-concentrating hormone; pro-melanin concentrating hormone
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaaaatgaatctctcttcctatatattaatactaactttttctttgttttctcaaggtattttactttcagcatccaagtccataagaaatttagatgatgacatggtatttaatacattcaggttggggaaaggctttcagaaggaagacactgcagaaaaatcagttattgctccttccctggaacaatataaaaatgatgagagcagtttcatgaacgaagaggaaaataaagtttcaaagaacacaggctccaaacataatttcttaaatcatggtctgccactgaatctggctataaaaccttatcttgcactaaaaggatctgtagctttcccagctgagaatggagttcagaatactgaatcaacacaagaaaagagagaaattggggatgaagaaaactcagctaaatttcctataggaaggagagattttgacatgctcagatgtatgctgggaagagtctaccgaccttgttggcaagtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - core-binding factor, beta subunit
- SEC11 homolog C (S. cerevisiae)
- ras homolog gene family, member A
- dual specificity phosphatase 14

Buy PMCH-pro-melanin-concentrating hormone Gene now

Add to cart