Login to display prices
Login to display prices
CBFB-core-binding factor, beta subunit Gene View larger

CBFB-core-binding factor, beta subunit Gene

PTXBC018509

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CBFB-core-binding factor, beta subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CBFB-core-binding factor, beta subunit Gene

Proteogenix catalog: PTXBC018509
Ncbi symbol: CBFB
Product name: CBFB-core-binding factor, beta subunit Gene
Size: 2ug
Accessions: BC018509
Gene id: 865
Gene description: core-binding factor, beta subunit
Synonyms: PEBP2B; core-binding factor subunit beta; CBF-beta; PEA2-beta; PEBP2-beta; SL3-3 enhancer factor 1 beta subunit; SL3-3 enhancer factor 1 subunit beta; SL3/AKV core-binding factor beta subunit; polyomavirus enhancer binding protein 2, beta subunit; core-binding factor beta subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcgcgtcgtgcccgaccagagaagcaagttcgagaacgaggagttttttaggaagctgagccgcgagtgtgagattaagtacacgggcttcagggaccggccccacgaggaacgccaggcacgcttccagaacgcctgccgcgacggccgctcggaaatcgcttttgtggccacaggaaccaatctgtctctccagttttttccggccagctggcagggagaacagcgacaaacacctagccgagagtatgtcgacttagaaagagaagcaggcaaggtatatttgaaggctcccatgattctgaatggagtctgtgttatctggaaaggctggattgatctccaaagactggatggtatgggctgtctggagtttgatgaggagcgagcccagcaggaggatgcattagcacaacaggcctttgaagaggctcggagaaggacacgcgaatttgaagatagagacaggtctcatcgggaggaaatggaggtgagagtttcacagctgctggcagtaactggcaagaagacaacaagaccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: