TAF12-TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa Gene View larger

TAF12-TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TAF12-TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TAF12-TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011986
Product type: DNA & cDNA
Ncbi symbol: TAF12
Origin species: Human
Product name: TAF12-TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa Gene
Size: 2ug
Accessions: BC011986
Gene id: 6883
Gene description: TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa
Synonyms: TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa; TAF2J; TAFII20; transcription initiation factor TFIID subunit 12; TAFII-20/TAFII-15; TAFII20/TAFII15; TATA box binding protein (TBP)-associated factor, RNA polymerase II, J, 20kD; transcription initiation factor TFIID 20/15 kDa subunits; TATA-box binding protein associated factor 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccagtttggcccctcagccctaatcaacctctccaatttctcatccataaaaccggaaccagccagcacccctccacaaggctccatggccaatagtactgcagtggtaaagataccaggcactcctggggcaggaggtcgtcttagccctgaaaacaatcaggtattgaccaagaagaaattacaggacttagtaagagaagtggatcctaatgagcagttggatgaagatgtggaggagatgctgctgcagattgctgatgattttatcgagagtgtggtgacagcagcctgtcagcttgcgcggcatcgcaagtctagcaccctggaggtgaaagatgtccagctgcatttagagcgccagtggaacatgtggatcccaggatttggctctgaagaaatccgaccctacaaaaaagcttgcaccacagaagctcacaaacagagaatggcattgatccggaaaacaaccaagaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)
- glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)
- lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
- TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa

Buy TAF12-TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa Gene now

Add to cart