Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TAF12-TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa Gene
PTXBC011986
New product
Data sheet of TAF12-TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TAF12-TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011986 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TAF12 |
| Origin species: | Human |
| Product name: | TAF12-TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa Gene |
| Size: | 2ug |
| Accessions: | BC011986 |
| Gene id: | 6883 |
| Gene description: | TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa |
| Synonyms: | TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 20kDa; TAF2J; TAFII20; transcription initiation factor TFIID subunit 12; TAFII-20/TAFII-15; TAFII20/TAFII15; TATA box binding protein (TBP)-associated factor, RNA polymerase II, J, 20kD; transcription initiation factor TFIID 20/15 kDa subunits; TATA-box binding protein associated factor 12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaccagtttggcccctcagccctaatcaacctctccaatttctcatccataaaaccggaaccagccagcacccctccacaaggctccatggccaatagtactgcagtggtaaagataccaggcactcctggggcaggaggtcgtcttagccctgaaaacaatcaggtattgaccaagaagaaattacaggacttagtaagagaagtggatcctaatgagcagttggatgaagatgtggaggagatgctgctgcagattgctgatgattttatcgagagtgtggtgacagcagcctgtcagcttgcgcggcatcgcaagtctagcaccctggaggtgaaagatgtccagctgcatttagagcgccagtggaacatgtggatcccaggatttggctctgaagaaatccgaccctacaaaaaagcttgcaccacagaagctcacaaacagagaatggcattgatccggaaaacaaccaagaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) - glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) - lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase) - TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa |