Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ILF3-interleukin enhancer binding factor 3, 90kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ILF3-interleukin enhancer binding factor 3, 90kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003086 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ILF3 |
| Origin species: | Human |
| Product name: | ILF3-interleukin enhancer binding factor 3, 90kDa Gene |
| Size: | 2ug |
| Accessions: | BC003086 |
| Gene id: | 3609 |
| Gene description: | interleukin enhancer binding factor 3, 90kDa |
| Synonyms: | CBTF; DRBF; DRBP76; MMP4; MPHOSPH4; MPP4; NF-AT-90; NF110; NF110b; NF90; NF90a; NF90b; NFAR; NFAR-1; NFAR2; TCP110; TCP80; interleukin enhancer-binding factor 3; M-phase phosphoprotein 4; double-stranded RNA-binding protein, 76 kD; dsRNA binding protein NFAR-2/MPP4; interleukin enhancer binding factor 3, 90kD; interleukin enhancer binding factor 3, 90kDa; nuclear factor associated with dsRNA; nuclear factor of activated T-cells 90 kDa; nuclear factor of activated T-cells, 90 kD; translational control protein 80; interleukin enhancer binding factor 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgttcatgtcctatctcctctcctggacacattaaggggttgggacaagaagagactcctgtgagatcagcagacctcgtgtttaaggagagaatgcctgcctgcaacactcatggagagggacacttcctggccccacctgctaaatacctccaaactctgggcaggcgcctgcattctcaacacaggacttcccttaacagtttccggatcagtgaccaccaccacgttcaggtttctgaatgcagacccaccacgagggatggattccacccgcccgccctgctgcagatacatgcggcacagcaggcacgtgcctggagagaacagctcctgagcacagcacccttggagccctcaccccgctcacgatcctcaccagtgctgatgatgccgtcatgctgctggcctgagacagtatcccagctacaacaggacgacaccgggttcaggaatatgtggctatcaccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - non-metastatic cells 3, protein expressed in - insulin-like growth factor 2 (somatomedin A) - ubiquitin-conjugating enzyme E2T (putative) - Sjogren syndrome/scleroderma autoantigen 1 |