ILF3-interleukin enhancer binding factor 3, 90kDa Gene View larger

ILF3-interleukin enhancer binding factor 3, 90kDa Gene

PTXBC003086

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ILF3-interleukin enhancer binding factor 3, 90kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ILF3-interleukin enhancer binding factor 3, 90kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003086
Product type: DNA & cDNA
Ncbi symbol: ILF3
Origin species: Human
Product name: ILF3-interleukin enhancer binding factor 3, 90kDa Gene
Size: 2ug
Accessions: BC003086
Gene id: 3609
Gene description: interleukin enhancer binding factor 3, 90kDa
Synonyms: CBTF; DRBF; DRBP76; MMP4; MPHOSPH4; MPP4; NF-AT-90; NF110; NF110b; NF90; NF90a; NF90b; NFAR; NFAR-1; NFAR2; TCP110; TCP80; interleukin enhancer-binding factor 3; M-phase phosphoprotein 4; double-stranded RNA-binding protein, 76 kD; dsRNA binding protein NFAR-2/MPP4; interleukin enhancer binding factor 3, 90kD; interleukin enhancer binding factor 3, 90kDa; nuclear factor associated with dsRNA; nuclear factor of activated T-cells 90 kDa; nuclear factor of activated T-cells, 90 kD; translational control protein 80; interleukin enhancer binding factor 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgttcatgtcctatctcctctcctggacacattaaggggttgggacaagaagagactcctgtgagatcagcagacctcgtgtttaaggagagaatgcctgcctgcaacactcatggagagggacacttcctggccccacctgctaaatacctccaaactctgggcaggcgcctgcattctcaacacaggacttcccttaacagtttccggatcagtgaccaccaccacgttcaggtttctgaatgcagacccaccacgagggatggattccacccgcccgccctgctgcagatacatgcggcacagcaggcacgtgcctggagagaacagctcctgagcacagcacccttggagccctcaccccgctcacgatcctcaccagtgctgatgatgccgtcatgctgctggcctgagacagtatcccagctacaacaggacgacaccgggttcaggaatatgtggctatcaccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - non-metastatic cells 3, protein expressed in
- insulin-like growth factor 2 (somatomedin A)
- ubiquitin-conjugating enzyme E2T (putative)
- Sjogren syndrome/scleroderma autoantigen 1

Buy ILF3-interleukin enhancer binding factor 3, 90kDa Gene now

Add to cart