Login to display prices
Login to display prices
RBM3-RNA binding motif (RNP1, RRM) protein 3 Gene View larger

RBM3-RNA binding motif (RNP1, RRM) protein 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBM3-RNA binding motif (RNP1, RRM) protein 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RBM3-RNA binding motif (RNP1, RRM) protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006825
Product type: DNA & cDNA
Ncbi symbol: RBM3
Origin species: Human
Product name: RBM3-RNA binding motif (RNP1, RRM) protein 3 Gene
Size: 2ug
Accessions: BC006825
Gene id: 5935
Gene description: RNA binding motif (RNP1, RRM) protein 3
Synonyms: IS1-RNPL; RNPL; RNA-binding protein 3; RNA-binding motif protein 3; RNA binding motif (RNP1, RRM) protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctctgaagaaggaaagctcttcgtgggagggctcaactttaacaccgacgagcaggcactggaagaccacttcagcagtttcggacctatctctgaggtggtcgttgtcaaggaccgggagactcagcggtccaggggttttggtttcatcaccttcaccaacccagagcatgcttcagttgccatgagagccatgaacggagagtctctggatggtcgtcagatccgtgtggatcatgcaggcaagtctgctcggggaaccagaggaggtggctttggggcccatgggcgtggtcgcagctactctagaggtggtggggaccagggctatgggagtggcaggtattatgacagtcgacctggagggtatggatatggatatggacgttccagagactataatggcagaaaccagggtggttatgaccgctactcaggaggaaattacagagacaattatgacaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 15 open reading frame 15
- chromosome 19 open reading frame 41
- chromosome 19 open reading frame 43
- RAB, member RAS oncogene family-like 5