IL1F5-interleukin 1 family, member 5 (delta) Gene View larger

IL1F5-interleukin 1 family, member 5 (delta) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL1F5-interleukin 1 family, member 5 (delta) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IL1F5-interleukin 1 family, member 5 (delta) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024747
Product type: DNA & cDNA
Ncbi symbol: IL1F5
Origin species: Human
Product name: IL1F5-interleukin 1 family, member 5 (delta) Gene
Size: 2ug
Accessions: BC024747
Gene id: 26525
Gene description: interleukin 1 family, member 5 (delta)
Synonyms: IL1F5 (Canonical product IL-1F5a); IL1F5; FIL1; FIL1(DELTA); FIL1D; IL-36Ra; IL1HY1; IL1L1; IL1RP3; IL36RA; PSORP; PSORS14; interleukin-36 receptor antagonist protein; IL-1 related protein 3; IL-1F5 (IL-1HY1, FIL1-delta, IL-1RP3, IL-1L1, IL-1-delta); IL-1ra homolog 1; interleukin 1 family, member 5 (delta); interleukin-1 HY1; interleukin-1 receptor antagonist homolog 1; interleukin-1-like protein 1; interleukin 36 receptor antagonist
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcctgagtggggcgctgtgcttccgaatgaaggactcggcattgaaggtgctttatctgcataataaccagcttctagctggagggctgcatgcagggaaggtcattaaaggtgaagagatcagcgtggtccccaatcggtggctggatgccagcctgtcccccgtcatcctgggtgtccagggtggaagccagtgcctgtcatgtggggtggggcaggagccgactctaacactagagccagtgaacatcatggagctctatcttggtgccaaggaatccaagagcttcaccttctaccggcgggacatggggctcacctccagcttcgagtcggctgcctacccgggctggttcctgtgcacggtgcctgaagccgatcagcctgtcagactcacccagcttcccgagaatggtggctggaatgcccccatcacagacttctacttccagcagtgtgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif (RNP1, RRM) protein 3
- chromosome 15 open reading frame 15
- chromosome 19 open reading frame 41
- chromosome 19 open reading frame 43

Buy IL1F5-interleukin 1 family, member 5 (delta) Gene now

Add to cart