Login to display prices
Login to display prices
ZMAT4-zinc finger, matrin type 4 Gene View larger

ZMAT4-zinc finger, matrin type 4 Gene

PTXBC019598

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZMAT4-zinc finger, matrin type 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZMAT4-zinc finger, matrin type 4 Gene

Proteogenix catalog: PTXBC019598
Ncbi symbol: ZMAT4
Product name: ZMAT4-zinc finger, matrin type 4 Gene
Size: 2ug
Accessions: BC019598
Gene id: 79698
Gene description: zinc finger, matrin type 4
Synonyms: zinc finger matrin-type protein 4; zinc finger matrin-type 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtcctccgatattgatcaggatttattcacagacagttactgcaaggtgtgcagtgcacagctgatctccgaatcgcagcgtgtggcccactacgagagtcgaaaacatgcaagcaaagtccgactgtattacatgcttcaccccagggatggagggtgtcctgccaagaggctccggtcagaaaatggaagtgatgccgacatggtggataagaacaagtgctgcacactctgcaacatgtcattcacttcagcggtggtggccgattcccattatcaaggcaaaatccacgccaagaggttaaaactcttgctaggagagaagaccccattaaagaccacaggtctgaggcgcaattacagatgtgccatctgcagtgtctccctaaactcaatagaacagtatcatgcccatctgaaaggatctaaacaccagaccaacctgaagaataagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: