Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ZMAT5-zinc finger, matrin type 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZMAT5-zinc finger, matrin type 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009717 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZMAT5 |
| Origin species: | Human |
| Product name: | ZMAT5-zinc finger, matrin type 5 Gene |
| Size: | 2ug |
| Accessions: | BC009717 |
| Gene id: | 55954 |
| Gene description: | zinc finger, matrin type 5 |
| Synonyms: | SNRNP20; U11/U12-20K; ZC3H19; zinc finger matrin-type protein 5; U11/U12 small nuclear ribonucleoprotein 20 kDa protein; U11/U12 snRNP 20 kDa protein; U11/U12 snRNP 20K; zinc finger CCCH-type containing 19; zinc finger matrin-type 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaagcgatacttctgtgactactgcgaccgctccttccaggacaacctccacaaccgcaagaagcacctgaacgggctgcagcacctcaaggccaagaaggtctggtacgacatgttccgagatgcagctgccatcttgctggatgagcagaacaagcggccctgcaggaagtttctactgacaggccagtgcgactttggctccaactgcagattttcccacatgtcagagcgagacctgcaggagctgagcatccaggtggaggaggagaggcgagccagggagtggctactagatgctcctgagctccccgagggccatctggaggactggctggagaagagagccaagcggctgagctcagccccaagtagcagggctgaacccatcagaaccactgtcttccagtaccccgtgggctggccaccagttcaggagctgcctccatccctgcgggcacccccacctggggggtggcctctgcagcccagagtccagtggggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - kinesin family member 16B - PDGFA associated protein 1 - FUN14 domain containing 2 - apoptosis enhancing nuclease |