ZMAT5-zinc finger, matrin type 5 Gene View larger

ZMAT5-zinc finger, matrin type 5 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZMAT5-zinc finger, matrin type 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZMAT5-zinc finger, matrin type 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009717
Product type: DNA & cDNA
Ncbi symbol: ZMAT5
Origin species: Human
Product name: ZMAT5-zinc finger, matrin type 5 Gene
Size: 2ug
Accessions: BC009717
Gene id: 55954
Gene description: zinc finger, matrin type 5
Synonyms: SNRNP20; U11/U12-20K; ZC3H19; zinc finger matrin-type protein 5; U11/U12 small nuclear ribonucleoprotein 20 kDa protein; U11/U12 snRNP 20 kDa protein; U11/U12 snRNP 20K; zinc finger CCCH-type containing 19; zinc finger matrin-type 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaagcgatacttctgtgactactgcgaccgctccttccaggacaacctccacaaccgcaagaagcacctgaacgggctgcagcacctcaaggccaagaaggtctggtacgacatgttccgagatgcagctgccatcttgctggatgagcagaacaagcggccctgcaggaagtttctactgacaggccagtgcgactttggctccaactgcagattttcccacatgtcagagcgagacctgcaggagctgagcatccaggtggaggaggagaggcgagccagggagtggctactagatgctcctgagctccccgagggccatctggaggactggctggagaagagagccaagcggctgagctcagccccaagtagcagggctgaacccatcagaaccactgtcttccagtaccccgtgggctggccaccagttcaggagctgcctccatccctgcgggcacccccacctggggggtggcctctgcagcccagagtccagtggggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kinesin family member 16B
- PDGFA associated protein 1
- FUN14 domain containing 2
- apoptosis enhancing nuclease

Buy ZMAT5-zinc finger, matrin type 5 Gene now

Add to cart