Login to display prices
Login to display prices
FUNDC2-FUN14 domain containing 2 Gene View larger

FUNDC2-FUN14 domain containing 2 Gene

PTXBC000255

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FUNDC2-FUN14 domain containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FUNDC2-FUN14 domain containing 2 Gene

Proteogenix catalog: PTXBC000255
Ncbi symbol: FUNDC2
Product name: FUNDC2-FUN14 domain containing 2 Gene
Size: 2ug
Accessions: BC000255
Gene id: 65991
Gene description: FUN14 domain containing 2
Synonyms: DC44; HCBP6; HCC3; PD03104; FUN14 domain-containing protein 2; HCC-3; cervical cancer oncogene 3; cervical cancer proto-oncogene 3 protein; hepatitis C virus core-binding protein 6; FUN14 domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaacatctgccccacgtgccggaagccaagtggtggcgacaactgcgcgccactccgcggcctaccgcgcagatcctctacgtgtgtcctcgcgagacaagctcaccgaaatggccgcgtccagtcaaggaaactttgagggaaattttgagtcactggaccttgcggaatttgctaagaagcagccatggtggcgtaagctgttcgggcaggaatctggaccttcagcagaaaagtatagcgtggcaacccagctgttcattggaggtgtcactggatggtgcacaggtttcatattccagaaggttggaaagttggctgcaacagctgtgggaggtggattttttctccttcagcttgcaaaccatactgggtacatcaaagttgactggcaacgagtggagaaggacatgaagaaagccaaagagcagctgaagatccgtaagagcaatcagatacctactgaggtcaggagcaaagctgaggaggtggtgtcatttgtgaagaagaatgttctagtaactgggggatttttcggaggctttctgcttggcatggcatcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: