YEATS4-YEATS domain containing 4 Gene View larger

YEATS4-YEATS domain containing 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of YEATS4-YEATS domain containing 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about YEATS4-YEATS domain containing 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000994
Product type: DNA & cDNA
Ncbi symbol: YEATS4
Origin species: Human
Product name: YEATS4-YEATS domain containing 4 Gene
Size: 2ug
Accessions: BC000994
Gene id: 8089
Gene description: YEATS domain containing 4
Synonyms: 4930573H17Rik; B230215M10Rik; NUBI-1; YAF9; YEATS domain-containing protein 4; NuMA binding protein 1; glioma-amplified sequence 41; nuBI1; nuMA-binding protein 1; YEATS domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcaagagaatggccgaatttgggcctgactccggcgggagagtaaagggtgttactatcgttaaaccaatagtttacggtaatgttgctcggtattttggaaagaaaagagaagaagatgggcacactcatcagtggacagtatatgtgaaaccatatagaaatgaggatatgtcagcatatgtgaagaaaatccagtttaaattacatgaaagctatggcaatcctttaagagttgttactaaacctccatatgaaattactgaaacaggatggggtgaattcgaaataatcatcaaaatatttttcattgaccctaatgaaagacctgtaaccctgtatcatttgctaaagctgtttcaatcagacaccaatgcaatgctggggaaaaagacagtggtttcagagttctatgatgaaatgatatttcaagacccaacagcaatgatgcaacaattattgacaacatctcgtcagctaacattaggagcctataagcatgaaacagaatttgcagagcttgaagtgaaaaccagagaaaaattagaagctgctaagaaaaaaacaagctttgagattgcagagcttaaggagagattaaaagcaagtcgtgaaactataaattgtttaaaaaatgaaatcagaaaacttgaagaagatgaccaagcaaaagacatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - stromal antigen 3-like 1
- erythroid associated factor
- XRCC6 binding protein 1
- cytochrome b5 reductase 1

Buy YEATS4-YEATS domain containing 4 Gene now

Add to cart