Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of XRCC6BP1-XRCC6 binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about XRCC6BP1-XRCC6 binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033881 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | XRCC6BP1 |
| Origin species: | Human |
| Product name: | XRCC6BP1-XRCC6 binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC033881 |
| Gene id: | 91419 |
| Gene description: | XRCC6 binding protein 1 |
| Synonyms: | XRCC6BP1; mitochondrial inner membrane protease ATP23 homolog; Ku70-binding protein 3; XRCC6-binding protein 1; ATP23 metallopeptidase and ATP synthase assembly factor homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgggagctccggacgagcgccggcggggccccgcggcaggggagcagctgcagcagcaacacgtctcttgccaggtcttccccgagcgtctggcccaggggaatccccagcaagggttcttctccagcttcttcacctgcaaccagaagtgccagcttaggctcctgaagacgctggagacaagtaggagccatgacctggaggctgtggttccacagaatgggtctgagaccgggtgggcgaggaagggcctgggcaacacctggccaggggcttcaggttcagcacagagtctagacagactgggcatcatgggggctgggttgggagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome b5 reductase 1 - casein kinase 1, gamma 1 - CDGSH iron sulfur domain 2 - deleted in bladder cancer 1 |