KIF16B-kinesin family member 16B Gene View larger

KIF16B-kinesin family member 16B Gene

PTXBC034984

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KIF16B-kinesin family member 16B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KIF16B-kinesin family member 16B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034984
Product type: DNA & cDNA
Ncbi symbol: KIF16B
Origin species: Human
Product name: KIF16B-kinesin family member 16B Gene
Size: 2ug
Accessions: BC034984
Gene id: 55614
Gene description: kinesin family member 16B
Synonyms: kinesin-like protein KIF16B; C20orf23; KISC20ORF; SNX23; kinesin motor protein; sorting nexin 23; testis secretory sperm-binding protein Li 201a; kinesin family member 16B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgccaggatcaatgcttacattgaagaagaagtccaaagacgccttcaggatttgcatcgtgtgattagtgaaggctgcagtacatctgcagacacgatgaaggataatgagaaacttcacaatggcaccattcaacgtaaactaaaatatgagcggatggtttctcgctctttgggcgcaaatccagatgacctgaaggacccaattaaaattagtatcccacgctacgtcctctgcgggcaaggaaaggatgcacacttcgagtttgaggtcaagcttgctgcccttgaatttcctccaaagaaactatttggaaataaggatgaacgtgtgattgctgagagacgaagtcacttagagaaatacctcagggactttttcagcgtgatgctccagtccgcaacatctcccctccacatcaacaaagtgggactgactctctcgaaacataccatttgtgagttttcaccattcttcaagaaaggagtctttgactacagcagccacgggacggggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PDGFA associated protein 1
- FUN14 domain containing 2
- apoptosis enhancing nuclease
- YEATS domain containing 4

Buy KIF16B-kinesin family member 16B Gene now

Add to cart