Login to display prices
Login to display prices
MGST3-microsomal glutathione S-transferase 3 Gene View larger

MGST3-microsomal glutathione S-transferase 3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGST3-microsomal glutathione S-transferase 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MGST3-microsomal glutathione S-transferase 3 Gene

Proteogenix catalog: PTXBC000505
Ncbi symbol: MGST3
Product name: MGST3-microsomal glutathione S-transferase 3 Gene
Size: 2ug
Accessions: BC000505
Gene id: 4259
Gene description: microsomal glutathione S-transferase 3
Synonyms: GST-III; microsomal glutathione S-transferase 3; microsomal GST-3; microsomal GST-III; microsomal glutathione S-transferase III
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtcctctctaaggaatatggttttgtgcttctaactggtgctgccagctttataatggtggcccacctagccatcaatgtttccaaggcccgcaagaagtacaaagtggagtatcctatcatgtacagcacggaccctgaaaatgggcacatcttcaactgcattcagcgagcccaccagaacacgttggaagtgtatcctcccttcttattttttctagctgttggaggtgtttaccacccgcgtatagcttctggcctgggcttggcctggattgttggacgagttctttatgcttatggctattacacgggagaacccagcaagcgtagtcgaggagccctggggtccatcgccctcctgggcttggtgggcacaactgtgtgctctgctttccagcatcttggttgggttaaaagtggcttgggcagtggacccaaatgctgccattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: