Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DUSP23-dual specificity phosphatase 23 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DUSP23-dual specificity phosphatase 23 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001140 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DUSP23 |
| Origin species: | Human |
| Product name: | DUSP23-dual specificity phosphatase 23 Gene |
| Size: | 2ug |
| Accessions: | BC001140 |
| Gene id: | 54935 |
| Gene description: | dual specificity phosphatase 23 |
| Synonyms: | DUSP25; LDP-3; MOSP; VHZ; dual specificity protein phosphatase 23; VH1-like member Z; VH1-like phosphatase Z; low-molecular-mass dual-specificity phosphatase 3; testicular tissue protein Li 59; dual specificity phosphatase 23 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcgtgcagccccccaacttctcctgggtgcttccgggccggctggcgggactggcgctgccgcggctccccgcccactaccagttcctgttggacctgggcgtgcggcacctggtgtccctgacggagcgcgggccccctcacagcgacagctgccccggcctcaccctgcaccgcctgcgcatccccgacttctgcccgccggcccccgaccagatcgaccgcttcgtgcagatcgtggacgaggccaacgcacggggagaggctgtgggagtgcactgtgctctgggctttggccgcactggcaccatgctggcctgttacctggtgaaggagcggggcttggctgcaggagatgccattgctgaaatccgacgactacgacccggctccatcgagacctatgagcaggagaaagcagtcttccagttctaccagcgaacgaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pro-melanin-concentrating hormone - core-binding factor, beta subunit - SEC11 homolog C (S. cerevisiae) - ras homolog gene family, member A |