IL20RB-interleukin 20 receptor beta Gene View larger

IL20RB-interleukin 20 receptor beta Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL20RB-interleukin 20 receptor beta Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IL20RB-interleukin 20 receptor beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033292
Product type: DNA & cDNA
Ncbi symbol: IL20RB
Origin species: Human
Product name: IL20RB-interleukin 20 receptor beta Gene
Size: 2ug
Accessions: BC033292
Gene id: 53833
Gene description: interleukin 20 receptor beta
Synonyms: DIRS1; FNDC6; IL-20R2; interleukin-20 receptor subunit beta; IL-20 receptor subunit beta; IL-20R-beta; IL-20RB; fibronectin type III domain containing 6; interleukin 20 receptor beta subunit; interleukin-20 receptor II; interleukin 20 receptor subunit beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcatctcttgatgtggagcccagtgatcgcgcctggagaaacagtgtactattctgtcgaataccagggggagtacgagagcctgtacacgagccacatctggatccccagcagctggtgctcactcactgaaggtcctgagtgtgatgtcactgatgacatcacggccactgtgccatacaaccttcgtgtcagggccacattgggctcacagacctcagcctggagcatcctgaagcatccctttaatagaaactcaaccatccttacccgacctgggatggagatcaccaaagatggcttccacctggttattgagctggaggacctggggccccagtttgagttccttgtggcctactggaggagggagcctggtgccgaggagaggccattcccctggtactggccctgtttgcctttgttggcttcatgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phospholipase A2, group XVI
- inducible T-cell co-stimulator
- transmembrane protein 185A
- Nipped-B homolog (Drosophila)

Buy IL20RB-interleukin 20 receptor beta Gene now

Add to cart