Login to display prices
Login to display prices
NIPBL-Nipped-B homolog (Drosophila) Gene View larger

NIPBL-Nipped-B homolog (Drosophila) Gene

PTXBC033847

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NIPBL-Nipped-B homolog (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NIPBL-Nipped-B homolog (Drosophila) Gene

Proteogenix catalog: PTXBC033847
Ncbi symbol: NIPBL
Product name: NIPBL-Nipped-B homolog (Drosophila) Gene
Size: 2ug
Accessions: BC033847
Gene id: 25836
Gene description: Nipped-B homolog (Drosophila)
Synonyms: NIPBL, cohesin loading factor; CDLS; CDLS1; IDN3; IDN3-B; Scc2; nipped-B-like protein; Nipped-B homolog; SCC2 homolog; delangin; sister chromatid cohesion 2 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaatgtttgccagaaaattcagctcctttaatcgaatttgcaaatgtgtcccagggtattttattacttctcatgttaaaacaacatttgaagaatctttgtggattttctgatagtaaaattcagaagtactctccatctgaatctgcaaaagtatatgataaagcgataaaccgaaaaacaggagttcattttcatccaaaacaaacactggacttcctgcggagtgacatggctaattccaaaatcacagaagaggtgaaaaggagtatagtaaaacagtatctagatttcaaacttctcatggaacatctggaccctgatgaagaagaagaagaaggggaggtttcagctagcacaaatgctcggaacaaagcaattacctcactgcttggaggaggcagccctaaaaataatacagcagcagagacagaagatgatgaaagtgatggggaggatagaggaggaggcacttcaggggtgaggcggaggaggagtcaacgtatttcgcagcgtattacgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: