CHMP5-chromatin modifying protein 5 Gene View larger

CHMP5-chromatin modifying protein 5 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHMP5-chromatin modifying protein 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHMP5-chromatin modifying protein 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016698
Product type: DNA & cDNA
Ncbi symbol: CHMP5
Origin species: Human
Product name: CHMP5-chromatin modifying protein 5 Gene
Size: 2ug
Accessions: BC016698
Gene id: 51510
Gene description: chromatin modifying protein 5
Synonyms: C9orf83; CGI-34; HSPC177; PNAS-2; SNF7DC2; Vps60; charged multivesicular body protein 5; SNF7 domain containing 2; SNF7 domain-containing protein 2; apoptosis-related protein PNAS-2; chromatin-modifying protein 5; hVps60; vacuolar protein sorting-associated protein 60
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccgactcttcgggaaagcgaaacccaaggctccgccgcccagcctgactggctgcattggcacggtggacagtagagcagaatccattgacaagaagatttctcgattggatgctgagctagtgaagtataaggatcagatcaagaagatgagagagggtcctgcaaagaatatggtcaagcagaaagccttgcgagttttaaagcaaaagaggatgtatgagcagcagcgggacaatcttgcccaacagtcattcaacatggaacaagccaattataccatccagtctttgaaggacaccaagaccacggttgatgctatgaaactgggagtaaaggaaatgaagaaggcatacaagcaagtgaagatcgaccagattgaggatttacaagaccagctagaggatatgatggaagatgcaaatgaaatccaagaagcactgagtcgcagttatggcaccccagaactggatgaagatgatttagaagcagagttggatgcactaggtgatgagcttctggctgatgaagacagttcttatttggatgaggcagcatctgcacctgcaattccagaaggtgttcccactgatacaaaaaacaaggatggagttctggtggatgaatttggattgccacagatccctgcttcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thiopurine S-methyltransferase
- asialoglycoprotein receptor 2
- rhomboid domain containing 1
- deoxyribonuclease I-like 3

Buy CHMP5-chromatin modifying protein 5 Gene now

Add to cart