TPMT-thiopurine S-methyltransferase Gene View larger

TPMT-thiopurine S-methyltransferase Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPMT-thiopurine S-methyltransferase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TPMT-thiopurine S-methyltransferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009596
Product type: DNA & cDNA
Ncbi symbol: TPMT
Origin species: Human
Product name: TPMT-thiopurine S-methyltransferase Gene
Size: 2ug
Accessions: BC009596
Gene id: 7172
Gene description: thiopurine S-methyltransferase
Synonyms: TPMTD; thiopurine S-methyltransferase; S-adenosyl-L-methionine:thiopurine S-methyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaaaaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgcttttcatcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaaggcaagagtggactgagggtattttttcctctttgcggaaaagcggttgagatgaaatggtttgcagaccggggacacagtgtagttggtgtggaaatcagtgaacttgggatacaagaattttttacagagcagaatctttcttactcagaagaaccaatcaccgaaattcctggaaccaaagtatttaagagttcttcggggaacatttcattgtactgttgcagtatttttgatcttcccaggacaaatattggcaaatttgacatgatttgggatagaggagcattagttgccattaatccaggtgatcgcaaatgctatgcagatacaatgttttccctcctgggaaagaagtttcagtatctcctgtgtgttctttcttatgatccaactaaacatccaggtccaccattttatgttccacatgctgaaattgaaaggttgtttggtaaaatatgcaatatacgttgtcttgagaaggttgatgcttttgaagaacgacataaaagttggggaattgactgtctttttgaaaagttatatctacttacagaaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - asialoglycoprotein receptor 2
- rhomboid domain containing 1
- deoxyribonuclease I-like 3
- GTPase, IMAP family member 5

Buy TPMT-thiopurine S-methyltransferase Gene now

Add to cart