Login to display prices
Login to display prices
TPMT-thiopurine S-methyltransferase Gene View larger

TPMT-thiopurine S-methyltransferase Gene

PTXBC009596

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPMT-thiopurine S-methyltransferase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TPMT-thiopurine S-methyltransferase Gene

Proteogenix catalog: PTXBC009596
Ncbi symbol: TPMT
Product name: TPMT-thiopurine S-methyltransferase Gene
Size: 2ug
Accessions: BC009596
Gene id: 7172
Gene description: thiopurine S-methyltransferase
Synonyms: TPMTD; thiopurine S-methyltransferase; S-adenosyl-L-methionine:thiopurine S-methyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaaaaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgcttttcatcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaaggcaagagtggactgagggtattttttcctctttgcggaaaagcggttgagatgaaatggtttgcagaccggggacacagtgtagttggtgtggaaatcagtgaacttgggatacaagaattttttacagagcagaatctttcttactcagaagaaccaatcaccgaaattcctggaaccaaagtatttaagagttcttcggggaacatttcattgtactgttgcagtatttttgatcttcccaggacaaatattggcaaatttgacatgatttgggatagaggagcattagttgccattaatccaggtgatcgcaaatgctatgcagatacaatgttttccctcctgggaaagaagtttcagtatctcctgtgtgttctttcttatgatccaactaaacatccaggtccaccattttatgttccacatgctgaaattgaaaggttgtttggtaaaatatgcaatatacgttgtcttgagaaggttgatgcttttgaagaacgacataaaagttggggaattgactgtctttttgaaaagttatatctacttacagaaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: