Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PLA2G16-phospholipase A2, group XVI Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLA2G16-phospholipase A2, group XVI Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001387 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLA2G16 |
| Origin species: | Human |
| Product name: | PLA2G16-phospholipase A2, group XVI Gene |
| Size: | 2ug |
| Accessions: | BC001387 |
| Gene id: | 11145 |
| Gene description: | phospholipase A2, group XVI |
| Synonyms: | AdPLA; H-REV107-1; HRASLS3; HREV107; HREV107-1; HREV107-3; HRSL3; HRAS-like suppressor 3; Ca-independent phospholipase A1/2; H-rev 107 protein homolog; HRAS-like suppressor 1; adipose-specific PLA2; adipose-specific phospholipase A2; group XVI phospholipase A1/A2; group XVI phospholipase A2; renal carcinoma antigen NY-REN-65; phospholipase A2 group XVI |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgtgcgcccattccagagcctaagcctggagacctgattgagatttttcgccctttctacagacactgggccatctatgttggcgatggatatgtggttcatctggcccctccaagtgaggtcgcaggagctggtgcagccagtgtcatgtccgccctgactgacaaggccatcgtgaagaaggaattgctgtatgatgtggccgggagtgacaagtaccaggtcaacaacaaacatgatgacaagtactcgccgctgccctgcagcaaaatcatccagcgggcggaggagctggtggggcaggaggtgctctacaagctgaccagtgagaactgcgagcactttgtgaatgagctgcgctatggagtcgcccgcagtgaccaggtcagagatgtcatcatcgctgcaagcgttgcaggaatgggcttggcagccatgagccttattggagtcatgttctcaagaaacaagcgacaaaagcaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - inducible T-cell co-stimulator - transmembrane protein 185A - Nipped-B homolog (Drosophila) - chromatin modifying protein 5 |