ICOS-inducible T-cell co-stimulator Gene View larger

ICOS-inducible T-cell co-stimulator Gene

PTXBC028006

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ICOS-inducible T-cell co-stimulator Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ICOS-inducible T-cell co-stimulator Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028006
Product type: DNA & cDNA
Ncbi symbol: ICOS
Origin species: Human
Product name: ICOS-inducible T-cell co-stimulator Gene
Size: 2ug
Accessions: BC028006
Gene id: 29851
Gene description: inducible T-cell co-stimulator
Synonyms: AILIM; CD278; CVID1; inducible T-cell costimulator; activation-inducible lymphocyte immunomediatory molecule; inducible T-cell co-stimulator; inducible costimulator
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtcaggcctctggtatttctttctcttctgcttgcgcattaaagttttaacaggagaaatcaatggttctgccaattatgagatgtttatatttcacaacggaggtgtacaaattttatgcaaatatcctgacattgtccagcaatttaaaatgcagttgctgaaaggggggcaaatactctgcgatctcactaagacaaaaggaagtggaaacacagtgtccattaagagtctgaaattctgccattctcagttatccaacaacagtgtctctttttttctatacaacttggaccattctcatgccaactattacttctgcaacctatcaatttttgatcctcctccttttaaagtaactcttacaggaggatatttgcatatttatgaatcacaactttgttgccagctgaagttctggttacccataggatgtgcagcctttgttgtagtctgcattttgggatgcatacttatttgttggcttacaaaaaagatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 185A
- Nipped-B homolog (Drosophila)
- chromatin modifying protein 5
- chromatin modifying protein 5

Buy ICOS-inducible T-cell co-stimulator Gene now

Add to cart