PTS-6-pyruvoyltetrahydropterin synthase Gene View larger

PTS-6-pyruvoyltetrahydropterin synthase Gene

PTXBC009686

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTS-6-pyruvoyltetrahydropterin synthase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTS-6-pyruvoyltetrahydropterin synthase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009686
Product type: DNA & cDNA
Ncbi symbol: PTS
Origin species: Human
Product name: PTS-6-pyruvoyltetrahydropterin synthase Gene
Size: 2ug
Accessions: BC009686
Gene id: 5805
Gene description: 6-pyruvoyltetrahydropterin synthase
Synonyms: PTPS; 6-pyruvoyl tetrahydrobiopterin synthase; PTP synthase; 6-pyruvoyltetrahydropterin synthase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcacggaaggtggtggccgtcgctgccaggcacaagtgtcccgccgcatctccttcagcgcgagccaccgattgtacagtaaatttctaagtgatgaagaaaacttgaaactgtttgggaaatgcaacaatccaaatggccatgggcacaattataaagttgtggtgacagtacatggagagattgaccctgctacgggaatggttatgaatctggctgatctcaaaaaatatatggaggaggcgattatgcagccccttgatcataagaatctggatatggatgtgccatactttgcagatgtggtgagcacgactgaaaatgtagctgtttatatctgggacaacctccagaaagttcttcctgtaggagttctttataaagtaaaagtatacgaaactgacaataatattgtggtttataaaggagaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - regulator of G-protein signaling 3
- abhydrolase domain containing 13
- coiled-coil domain containing 69
- RAB1A, member RAS oncogene family

Buy PTS-6-pyruvoyltetrahydropterin synthase Gene now

Add to cart