Login to display prices
Login to display prices
PTS-6-pyruvoyltetrahydropterin synthase Gene View larger

PTS-6-pyruvoyltetrahydropterin synthase Gene

PTXBC009686

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTS-6-pyruvoyltetrahydropterin synthase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PTS-6-pyruvoyltetrahydropterin synthase Gene

Proteogenix catalog: PTXBC009686
Ncbi symbol: PTS
Product name: PTS-6-pyruvoyltetrahydropterin synthase Gene
Size: 2ug
Accessions: BC009686
Gene id: 5805
Gene description: 6-pyruvoyltetrahydropterin synthase
Synonyms: PTPS; 6-pyruvoyl tetrahydrobiopterin synthase; PTP synthase; 6-pyruvoyltetrahydropterin synthase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcacggaaggtggtggccgtcgctgccaggcacaagtgtcccgccgcatctccttcagcgcgagccaccgattgtacagtaaatttctaagtgatgaagaaaacttgaaactgtttgggaaatgcaacaatccaaatggccatgggcacaattataaagttgtggtgacagtacatggagagattgaccctgctacgggaatggttatgaatctggctgatctcaaaaaatatatggaggaggcgattatgcagccccttgatcataagaatctggatatggatgtgccatactttgcagatgtggtgagcacgactgaaaatgtagctgtttatatctgggacaacctccagaaagttcttcctgtaggagttctttataaagtaaaagtatacgaaactgacaataatattgtggtttataaaggagaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: