ZFAND2A-zinc finger, AN1-type domain 2A Gene View larger

ZFAND2A-zinc finger, AN1-type domain 2A Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZFAND2A-zinc finger, AN1-type domain 2A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZFAND2A-zinc finger, AN1-type domain 2A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029558
Product type: DNA & cDNA
Ncbi symbol: ZFAND2A
Origin species: Human
Product name: ZFAND2A-zinc finger, AN1-type domain 2A Gene
Size: 2ug
Accessions: BC029558
Gene id: 90637
Gene description: zinc finger, AN1-type domain 2A
Synonyms: AIRAP; AN1-type zinc finger protein 2A; arsenite inducible RNA associated protein; zinc finger, AN1-type domain 2A; zinc finger AN1-type containing 2A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtttcctgatttggggaagcattgttcagaaaagacttgcaagcagctagattttcttccagtaaaatgtgatgcatgtaaacaagatttctgtaaagatcattttccatacgctgcacataagtgtccgtttgcattccagaaggatgtgctcgtcccagtatgcccactctgtaataccccaatcccagtaaaaaagggccagataccagacgtggtggttggtgatcacattgacagagactgtgactctcaccctgggaagaagaaagagaagatttttacataccgttgctcaaaagagggctgcaagaagaaagagatgctgcagatggtatgtgcccaatgtcacggcaacttctgtatccagcacagacaccctttggaccacagctgcagacacgggagtcgccccaccatcaaagctgggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 6-pyruvoyltetrahydropterin synthase
- regulator of G-protein signaling 3
- abhydrolase domain containing 13
- coiled-coil domain containing 69

Buy ZFAND2A-zinc finger, AN1-type domain 2A Gene now

Add to cart