C14orf1-chromosome 14 open reading frame 1 Gene View larger

C14orf1-chromosome 14 open reading frame 1 Gene

PTXBC002444

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C14orf1-chromosome 14 open reading frame 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C14orf1-chromosome 14 open reading frame 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002444
Product type: DNA & cDNA
Ncbi symbol: C14orf1
Origin species: Human
Product name: C14orf1-chromosome 14 open reading frame 1 Gene
Size: 2ug
Accessions: BC002444
Gene id: 11161
Gene description: chromosome 14 open reading frame 1
Synonyms: ERG28; NET51; chromosome 14 open reading frame 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagccgtttcctgaatgtgttaagaagttggctggttatggtgtccatcatagccatggggaacacgctgcagagcttccgagaccacacttttctctatgaaaagctctacactggcaagccaaaccttgtgaatggcctccaagctcggacctttgggatctggacgctgctctcatcagtgattcgctgcctctgtgccattgacattcacaacaagacgctctatcacatcacactctggaccttcctccttgccctggggcatttcctctctgagttgtttgtctatggaactgcagctcccacgattggcgtcctggcacccctgatggtggcaagtttctccatcctgggtatgctggtcgggctccggtatctagaagtagaaccagtatccagacagaagaagagaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CMT1A duplicated region transcript 4
- mitochondrial ribosomal protein L50
- ribosomal protein L13A pseudogene
- chromosome 1 open reading frame 52

Buy C14orf1-chromosome 14 open reading frame 1 Gene now

Add to cart