Login to display prices
Login to display prices
C1orf52-chromosome 1 open reading frame 52 Gene View larger

C1orf52-chromosome 1 open reading frame 52 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf52-chromosome 1 open reading frame 52 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf52-chromosome 1 open reading frame 52 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029538
Product type: DNA & cDNA
Ncbi symbol: C1orf52
Origin species: Human
Product name: C1orf52-chromosome 1 open reading frame 52 Gene
Size: 2ug
Accessions: BC029538
Gene id: 148423
Gene description: chromosome 1 open reading frame 52
Synonyms: UPF0690 protein C1orf52; gm117; BCL10-associated gene protein; chromosome 1 open reading frame 52
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcggaggagaaggaccctctgagctattttgcggcatacgggagcagcagctcaggctcctcggacgaggaggataacatcgagccggaggagacgagtcgcagaaccccggatccggcgaagtcggcgggcggctgtaggaacaaggcggagaagcggctcccgggacctgacgagctgtttaggagcgtgactcgcccggcctttctctacaatccgctcaacaaacagatagactgggagaggcacgtcgtcaaggcgcctgaggagcctccaaaggaattcaaaatatggaagtcaaattatgtaccacctcctgagacctacaccactgagaagaagcctccgcctccagagcttgacatggcaataaaatggtctaacatatatgaggacaatggtgatgatgctccacagaatgctaagaaagctaggcttctaccagaaggggaggagacgttggaatcagatgatgaaaaagatgagcatacttctaaaaagcgcaaagtagagccaggagaaccagcaaagaagaaaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 43
- mitochondrial ribosomal protein L11
- chromosome 9 open reading frame 95
- chromosome 1 open reading frame 83