MRPL50-mitochondrial ribosomal protein L50 Gene View larger

MRPL50-mitochondrial ribosomal protein L50 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL50-mitochondrial ribosomal protein L50 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL50-mitochondrial ribosomal protein L50 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032008
Product type: DNA & cDNA
Ncbi symbol: MRPL50
Origin species: Human
Product name: MRPL50-mitochondrial ribosomal protein L50 Gene
Size: 2ug
Accessions: BC032008
Gene id: 54534
Gene description: mitochondrial ribosomal protein L50
Synonyms: MRP-L50; 39S ribosomal protein L50, mitochondrial; L50mt; mitochondrial 39S ribosomal protein L50; mitochondrial ribosomal protein L50
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgcgatctgtgtcgggcattaccagaagagtcttcatgtggacagtctcagggacaccatgtagagaattttggtctcgattcagaaaagagaaagagccagtggttgttgagacagtagaagagaaaaaggaacctatcctagtgtgtccacctttacgaagccgagcatacacaccacctgaagatctccagagtcgtttggaatcttacgttaaagaagtttttggttcatctcttcctagtaattggcaagacatctccctggaagatagtcgtctaaagttcaatcttctggctcatttagctgatgacttgggtcatgtagtccctaactccagactccaccagatgtgcagggttagagatgtttttgatttctataatgtccctattcaagatagatctaaatttgatgaactcagtgcgagtaatctgccccccaatttgaaaatcacttggagttactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L13A pseudogene
- chromosome 1 open reading frame 52
- chromosome 1 open reading frame 43
- mitochondrial ribosomal protein L11

Buy MRPL50-mitochondrial ribosomal protein L50 Gene now

Add to cart