MGC34774-ribosomal protein L13A pseudogene Gene View larger

MGC34774-ribosomal protein L13A pseudogene Gene

PTXBC027852

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC34774-ribosomal protein L13A pseudogene Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC34774-ribosomal protein L13A pseudogene Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027852
Product type: DNA & cDNA
Ncbi symbol: MGC34774
Origin species: Human
Product name: MGC34774-ribosomal protein L13A pseudogene Gene
Size: 2ug
Accessions: BC027852
Gene id: 399670
Gene description: ribosomal protein L13A pseudogene
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactcagtctctgtagtcatgatgctcacatccaagcccctgcacatcctaggaagattcatcactaagccattactcttcactaattccatggaaaacttcgaactaactcctagcagacatggccgtgtgcaccatcaatcatgtcatgaagcacccaggacctacaaggtggctgctgaagacagcagaaagacagaacctggtgctcagtggccaaggccatcttgtgggccacccggcagccatcttggccaagtgggctctgctgggaaggaaactggtggtcgagcaccacgagggcatcaacatttctggcaatttctggagaaacaaattaaagtatctggccttcctctacaagcagatgagcaccaacccttcccaaggcccgcccgccccgccattcctgggcccccagcgcatcttttggtggccttgcagaaccaagtggggccaggctgccctggaccaccttatggtgttttatgggatctcactgccctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 52
- chromosome 1 open reading frame 43
- mitochondrial ribosomal protein L11
- chromosome 9 open reading frame 95

Buy MGC34774-ribosomal protein L13A pseudogene Gene now

Add to cart