VPS53-vacuolar protein sorting 53 homolog (S. cerevisiae) Gene View larger

VPS53-vacuolar protein sorting 53 homolog (S. cerevisiae) Gene

PTXBC029560

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VPS53-vacuolar protein sorting 53 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VPS53-vacuolar protein sorting 53 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029560
Product type: DNA & cDNA
Ncbi symbol: VPS53
Origin species: Human
Product name: VPS53-vacuolar protein sorting 53 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC029560
Gene id: 55275
Gene description: vacuolar protein sorting 53 homolog (S. cerevisiae)
Synonyms: VPS53, GARP complex subunit; HCCS1; PCH2E; hVps53L; pp13624; vacuolar protein sorting-associated protein 53 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtttgctgctgctggacacccactcgctgaagatggtcctgctcgatctcccctccatcagctcgcaggtggtgaggaaggcacccgccagctacaccaagatcgttgtcaaaggcatgacccgggctgagatgatcctcaaggtagtgatggcccctcatgaaccgttggtggtgtttgttgacaactacatcaaacttctcacagactgcaacacagaaacctttcagaagatactggacatgaaggggctgaagaggagtgagcagagcagcatgctggaactcctgcgccagcggctccccgcaccgccctcgggggcagaaagctccggctcactgtccctgacggcgccgacaccagagcaagagtcgtcacgcatccgcaagctcgagaaactcattaaaaagagactgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - non-metastatic cells 1, protein (NM23A) expressed in
- ARD1 homolog A, N-acetyltransferase (S. cerevisiae)
- glucose-fructose oxidoreductase domain containing 2
- intraflagellar transport 20 homolog (Chlamydomonas)

Buy VPS53-vacuolar protein sorting 53 homolog (S. cerevisiae) Gene now

Add to cart