Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NME1-non-metastatic cells 1, protein (NM23A) expressed in Gene
PTXBC000293
New product
Data sheet of NME1-non-metastatic cells 1, protein (NM23A) expressed in Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NME1-non-metastatic cells 1, protein (NM23A) expressed in Gene
| Proteogenix catalog: | PTXBC000293 |
| Ncbi symbol: | NME1 |
| Product name: | NME1-non-metastatic cells 1, protein (NM23A) expressed in Gene |
| Size: | 2ug |
| Accessions: | BC000293 |
| Gene id: | 4830 |
| Gene description: | non-metastatic cells 1, protein (NM23A) expressed in |
| Synonyms: | AWD; GAAD; NBS; NDKA; NDPK-A; NDPKA; NM23; NM23-H1; nucleoside diphosphate kinase A; NDP kinase A; granzyme A-activated DNase; metastasis inhibition factor nm23; non-metastatic cells 1, protein (NM23A) expressed in; tumor metastatic process-associated protein; NME/NM23 nucleoside diphosphate kinase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaactgtgagcgtaccttcattgcgatcaaaccagatggggtccagcggggtcttgtgggagagattatcaagcgttttgagcagaaaggattccgccttgttggtctgaaattcatgcaagcttccgaagatcttctcaaggaacactacgttgacctgaaggaccgtccattctttgccggcctggtgaaatacatgcactcagggccggtagttgccatggtctgggaggggctgaatgtggtgaagacgggccgagtcatgctcggggagaccaaccctgcagactccaagcctgggaccatccgtggagacttctgcatacaagttggcaggaacattatacatggcagtgattctgtggagagtgcagagaaggagatcggcttgtggtttcaccctgaggaactggtagattacacgagctgtgctcagaactggatctatgaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |