CNIH4-cornichon homolog 4 (Drosophila) Gene View larger

CNIH4-cornichon homolog 4 (Drosophila) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CNIH4-cornichon homolog 4 (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CNIH4-cornichon homolog 4 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000573
Product type: DNA & cDNA
Ncbi symbol: CNIH4
Origin species: Human
Product name: CNIH4-cornichon homolog 4 (Drosophila) Gene
Size: 2ug
Accessions: BC000573
Gene id: 29097
Gene description: cornichon homolog 4 (Drosophila)
Synonyms: CNIH-4; HSPC163; protein cornichon homolog 4; cornichon homolog 4; cornichon family AMPA receptor auxiliary protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcggtggtgttcgtcttctctctcctcgattgttgcgcgctcatcttcctctcggtctacttcataattacattgtctgatttagaatgtgattacattaatgctagatcatgttgctcaaaattaaacaagtgggtaattccagaattgattggccataccattgtcactgtattactgctcatgtcattgcactggttcatcttccttctcaacttacctgttgccacttggaatatatatcgatacattatggtgccgagtggtaacatgggagtgtttgatccaacagaaatacacaatcgagggcagctgaagtcacacatgaaagaagccatgatcaagcttggtttccacttgctctgcttcttcatgtatctttatagtatgatcttagctttgataaatgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribonuclease, RNase A family, 4
- dual specificity phosphatase 23
- pro-melanin-concentrating hormone
- core-binding factor, beta subunit

Buy CNIH4-cornichon homolog 4 (Drosophila) Gene now

Add to cart