CRABP2-cellular retinoic acid binding protein 2 Gene View larger

CRABP2-cellular retinoic acid binding protein 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CRABP2-cellular retinoic acid binding protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CRABP2-cellular retinoic acid binding protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001109
Product type: DNA & cDNA
Ncbi symbol: CRABP2
Origin species: Human
Product name: CRABP2-cellular retinoic acid binding protein 2 Gene
Size: 2ug
Accessions: BC001109
Gene id: 1382
Gene description: cellular retinoic acid binding protein 2
Synonyms: CRABP-II; RBP6; cellular retinoic acid-binding protein 2; cellular retinoic acid-binding protein II; cellular retinoic acid binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccaacttctctggcaactggaaaatcatccgatcggaaaacttcgaggaattgctcaaagtgctgggggtgaatgtgatgctgaggaagattgctgtggctgcagcgtccaagccagcagtggagatcaaacaggagggagacactttctacatcaaaacctccaccaccgtgcgcaccacagagattaacttcaaggttggggaggagtttgaggagcagactgtggatgggaggccctgtaagagcctggtgaaatgggagagtgagaataaaatggtctgtgagcagaagctcctgaagggagagggccccaagacctcgtggaccagagaactgaccaacgatggggaactgatcctgaccatgacggcggatgacgttgtgtgcaccagggtctacgtccgagagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peptidylprolyl isomerase A (cyclophilin A)
- RAB, member of RAS oncogene family-like 4
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 54
- eukaryotic translation initiation factor 6

Buy CRABP2-cellular retinoic acid binding protein 2 Gene now

Add to cart