Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CREM-cAMP responsive element modulator Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CREM-cAMP responsive element modulator Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017117 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CREM |
| Origin species: | Human |
| Product name: | CREM-cAMP responsive element modulator Gene |
| Size: | 2ug |
| Accessions: | BC017117 |
| Gene id: | 1390 |
| Gene description: | cAMP responsive element modulator |
| Synonyms: | CREM 2beta-a protein; CREM 2alpha-b protein; CREM-2; ICER; hCREM-2; cAMP-responsive element modulator; cAMP response element modulator; inducible cAMP early repressor ICER; cAMP responsive element modulator |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccatggaaacagttgaatcccagcatgatggaagtataacagcttctttgacagagagcaagtctgctcatgtgcagactcagactggccaaaattcaatccctgctttagctcaggtagcagcaattgcagagacagatgaatctgcagaatcagaaggtgtaattgattctcataaacgtagagaaatcctttcacgaagaccctcttataggaaaatactgaatgaactgtcctctgatgtgcctggtgttcccaagattgaagaagagagatcagaggaagaaggaacaccacctagtattgctaccatggcagtaccaactagcatatatcagactagcacggggcaatacagtatgtatgctgcaattcgatatgatacagtgctagctttaagtcttctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cornichon homolog 4 (Drosophila) - ribonuclease, RNase A family, 4 - dual specificity phosphatase 23 - pro-melanin-concentrating hormone |