CREM-cAMP responsive element modulator Gene View larger

CREM-cAMP responsive element modulator Gene

PTXBC017117

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CREM-cAMP responsive element modulator Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CREM-cAMP responsive element modulator Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017117
Product type: DNA & cDNA
Ncbi symbol: CREM
Origin species: Human
Product name: CREM-cAMP responsive element modulator Gene
Size: 2ug
Accessions: BC017117
Gene id: 1390
Gene description: cAMP responsive element modulator
Synonyms: CREM 2beta-a protein; CREM 2alpha-b protein; CREM-2; ICER; hCREM-2; cAMP-responsive element modulator; cAMP response element modulator; inducible cAMP early repressor ICER; cAMP responsive element modulator
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccatggaaacagttgaatcccagcatgatggaagtataacagcttctttgacagagagcaagtctgctcatgtgcagactcagactggccaaaattcaatccctgctttagctcaggtagcagcaattgcagagacagatgaatctgcagaatcagaaggtgtaattgattctcataaacgtagagaaatcctttcacgaagaccctcttataggaaaatactgaatgaactgtcctctgatgtgcctggtgttcccaagattgaagaagagagatcagaggaagaaggaacaccacctagtattgctaccatggcagtaccaactagcatatatcagactagcacggggcaatacagtatgtatgctgcaattcgatatgatacagtgctagctttaagtcttctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cornichon homolog 4 (Drosophila)
- ribonuclease, RNase A family, 4
- dual specificity phosphatase 23
- pro-melanin-concentrating hormone

Buy CREM-cAMP responsive element modulator Gene now

Add to cart