GOLGA7-golgi autoantigen, golgin subfamily a, 7 Gene View larger

GOLGA7-golgi autoantigen, golgin subfamily a, 7 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GOLGA7-golgi autoantigen, golgin subfamily a, 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GOLGA7-golgi autoantigen, golgin subfamily a, 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012032
Product type: DNA & cDNA
Ncbi symbol: GOLGA7
Origin species: Human
Product name: GOLGA7-golgi autoantigen, golgin subfamily a, 7 Gene
Size: 2ug
Accessions: BC012032
Gene id: 51125
Gene description: golgi autoantigen, golgin subfamily a, 7
Synonyms: GOLGA3AP1; GOLGA7A; HSPC041; golgin subfamily A member 7; Golgi complex-associated protein of 16kDa; golgi autoantigen, golgin subfamily a, 7; golgi complex-associated protein of 16 kDa; golgin A7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggccgcagcaggcgccggtgtccggaaaggtgttcattcagcgagactacagcagtggcacacgctgccagttccagaccaagttccctgcggagctggagaaccggattgataggcagcagtttgaagaaacagttcgaactctaaataacctttatgcagaagcagagaagcttggcggccagtcatatctcgaaggttgtttggcttgtttaacagcatataccatcttcctatgcatggaaactcattatgagaaggttctgaagaaagtctccaaatacattcaagagcagaatgagaagatctatgctccacaaggcctcctcctgacagaccctattgagcgaggactgcgagttattgaaattaccatttatgaagacagaggcatgagcagtggaagataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cellular retinoic acid binding protein 2
- peptidylprolyl isomerase A (cyclophilin A)
- RAB, member of RAS oncogene family-like 4
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 54

Buy GOLGA7-golgi autoantigen, golgin subfamily a, 7 Gene now

Add to cart