C3orf64-chromosome 3 open reading frame 64 Gene View larger

C3orf64-chromosome 3 open reading frame 64 Gene

PTXBC028935

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C3orf64-chromosome 3 open reading frame 64 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C3orf64-chromosome 3 open reading frame 64 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028935
Product type: DNA & cDNA
Ncbi symbol: C3orf64
Origin species: Human
Product name: C3orf64-chromosome 3 open reading frame 64 Gene
Size: 2ug
Accessions: BC028935
Gene id: 285203
Gene description: chromosome 3 open reading frame 64
Synonyms: C3orf64; AER61; AOS4; EOGT1; EGF domain-specific O-linked N-acetylglucosamine transferase; AER61 glycosyltransferase; EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase; EGF-O-GlcNAc transferase; extracellular O-linked N-acetylglucosamine transferase; EGF domain specific O-linked N-acetylglucosamine transferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatctcagctcactgcaacctctgccttctggattcaagtgattcttgtgccttagcctcccaagtagctgggattacaggcgtgcaccaccacgcccagttgatttttgtatttttgatagagacggagtttcaccatgttggccaggctggtctcgaactctgggttcaagaaatcctcccaccttgcctcccaaagtgctgggattacaggtgtgagccaccacgcatggccctgaactttctctttttaggaataccaaagttttcaactttttcagctttagaatttgtaaatatttttgtagaatatcatatgactgtaattccagagtgttccaacttgtttatgatatatttgggtaaatttacaactgttcttttatttgccataatctggttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 1
- CMT1A duplicated region transcript 4
- mitochondrial ribosomal protein L50
- ribosomal protein L13A pseudogene

Buy C3orf64-chromosome 3 open reading frame 64 Gene now

Add to cart