ABHD11-abhydrolase domain containing 11 Gene View larger

ABHD11-abhydrolase domain containing 11 Gene

PTXBC008251

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ABHD11-abhydrolase domain containing 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ABHD11-abhydrolase domain containing 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008251
Product type: DNA & cDNA
Ncbi symbol: ABHD11
Origin species: Human
Product name: ABHD11-abhydrolase domain containing 11 Gene
Size: 2ug
Accessions: BC008251
Gene id: 83451
Gene description: abhydrolase domain containing 11
Synonyms: protein ABHD11; PP1226; WBSCR21; Williams Beuren syndrome chromosome region 21; abhydrolase domain-containing protein 11; alpha/beta hydrolase domain-containing protein 11; abhydrolase domain containing 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggccatcaacatcgcagatgagctgccccgctcccgtgcccgaaaactggcggatgaacagctcagttctgtcatccaggacatggccgtgcggcagcacctgctcactaacctggtagaggtagacgggcgcttcgtgtggagggtgaacttggatgccctgacccagcacctagacaagatcttggctttcccacagaggcaggagtcctacctcgggccaacactctttctccttggtggaaactcccagttcgtgcatcccagccaccaccctgagattatgcggctcttccctcgggcccagatgcagacggtgccgaacgctggccactggatccacgctgaccgcccacaggacttcatagctgccatccgaggcttcctggtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, AN1-type domain 2A
- 6-pyruvoyltetrahydropterin synthase
- regulator of G-protein signaling 3
- abhydrolase domain containing 13

Buy ABHD11-abhydrolase domain containing 11 Gene now

Add to cart