Login to display prices
Login to display prices
C7orf49-chromosome 7 open reading frame 49 Gene View larger

C7orf49-chromosome 7 open reading frame 49 Gene

PTXBC000168

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C7orf49-chromosome 7 open reading frame 49 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C7orf49-chromosome 7 open reading frame 49 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000168
Product type: DNA & cDNA
Ncbi symbol: C7orf49
Origin species: Human
Product name: C7orf49-chromosome 7 open reading frame 49 Gene
Size: 2ug
Accessions: BC000168
Gene id: 78996
Gene description: chromosome 7 open reading frame 49
Synonyms: MRI; MRI-2; modulator of retrovirus infection homolog; chromosome 7 open reading frame 49
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggcccccaagaggatgagaatggcagcagtgccagtggcagcagcaagactccctgcgacaaggactgtgtactgcatgaatgaggctgagatagttgatgttgctctgggaatcctgattgagagccgcaaacaggaaaaggcctgcgagcagccggccctggcgggggctgataacccagagcactcccctccctgctccgtgtcgcctcacacaagttctgggagcagcagtgaggaagaggacagtgggaaacaggcactggctccaggcctcagcccttcccagaggccggggggttccagctctgcctgtagcaggagccctgaggaggaggaggaagaggatgtgctgaaatacgtccgggagatctttttcagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 3 open reading frame 64
- chromosome 14 open reading frame 1
- CMT1A duplicated region transcript 4
- mitochondrial ribosomal protein L50