C21orf77-chromosome 21 open reading frame 77 Gene View larger

C21orf77-chromosome 21 open reading frame 77 Gene

PTXBC027970

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C21orf77-chromosome 21 open reading frame 77 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C21orf77-chromosome 21 open reading frame 77 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027970
Product type: DNA & cDNA
Ncbi symbol: C21orf77
Origin species: Human
Product name: C21orf77-chromosome 21 open reading frame 77 Gene
Size: 2ug
Accessions: BC027970
Gene id: 55264
Gene description: chromosome 21 open reading frame 77
Synonyms: C21orf77; PRED77; TCP10A-2; T-complex protein 10A homolog 2; T-complex 10A-2; T-complex protein 10A-2; TCP10-like; t-complex 10 (a murine tcp homolog)-like; t-complex 10-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcgccctctcatctggcaccttcctggcctctttcccaggccccagttctgtccatgcagctgtgggtgcttcctgcattgcgggtctcacggggaggagacgagagtgcccctggttgagtcaggaaagaattctatcttcacgtcgctgccagcaaatgaccacagcagcttcacgacctctgcaggaacctatcttggtaaagaaacggggcctatgtggtggccgagcctcaggtgtggccgagcttcaggtgtggcccttatgcacagcacagcccaagcctgtgggcaccactcgccctgggctgcctggcacctggactccttcccatccttggccgaggtctgcgtggcccttcagggtcgaatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aspartic peptidase, retroviral-like 1
- microsomal glutathione S-transferase 3
- interleukin 1 family, member 5 (delta)
- RNA binding motif (RNP1, RRM) protein 3

Buy C21orf77-chromosome 21 open reading frame 77 Gene now

Add to cart