Login to display prices
Login to display prices
C21orf77-chromosome 21 open reading frame 77 Gene View larger

C21orf77-chromosome 21 open reading frame 77 Gene

PTXBC027970

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C21orf77-chromosome 21 open reading frame 77 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C21orf77-chromosome 21 open reading frame 77 Gene

Proteogenix catalog: PTXBC027970
Ncbi symbol: C21orf77
Product name: C21orf77-chromosome 21 open reading frame 77 Gene
Size: 2ug
Accessions: BC027970
Gene id: 55264
Gene description: chromosome 21 open reading frame 77
Synonyms: C21orf77; PRED77; TCP10A-2; T-complex protein 10A homolog 2; T-complex 10A-2; T-complex protein 10A-2; TCP10-like; t-complex 10 (a murine tcp homolog)-like; t-complex 10-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcgccctctcatctggcaccttcctggcctctttcccaggccccagttctgtccatgcagctgtgggtgcttcctgcattgcgggtctcacggggaggagacgagagtgcccctggttgagtcaggaaagaattctatcttcacgtcgctgccagcaaatgaccacagcagcttcacgacctctgcaggaacctatcttggtaaagaaacggggcctatgtggtggccgagcctcaggtgtggccgagcttcaggtgtggcccttatgcacagcacagcccaagcctgtgggcaccactcgccctgggctgcctggcacctggactccttcccatccttggccgaggtctgcgtggcccttcagggtcgaatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: