C15orf40-chromosome 15 open reading frame 40 Gene View larger

C15orf40-chromosome 15 open reading frame 40 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C15orf40-chromosome 15 open reading frame 40 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C15orf40-chromosome 15 open reading frame 40 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019820
Product type: DNA & cDNA
Ncbi symbol: C15orf40
Origin species: Human
Product name: C15orf40-chromosome 15 open reading frame 40 Gene
Size: 2ug
Accessions: BC019820
Gene id: 123207
Gene description: chromosome 15 open reading frame 40
Synonyms: UPF0235 protein C15orf40; chromosome 15 open reading frame 40
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctaagaaggctggtgcgacgaccaagggtaaaagccagagcaaggaaccagagagaccacttcctcccttaggtcctgtggcagttgatcctaaaggatgcgtcaccatagccatccatgcaaaacctggctccaaacaaaatgctgtaacagatttgacagcagaggctgtaaatgtagctattgcagcacctccatcagagggagaggctaatgctgagctctgtcggtatctttccaaggtcctagaactcaggaagagtgatgtggttttggataagggtggtaaatctcgtgaaaaggtggtgaagcttttggcttctacaactccagaagagatcttggagaaattaaaaaaggaagccaaaaaaacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 21 open reading frame 77
- aspartic peptidase, retroviral-like 1
- microsomal glutathione S-transferase 3
- interleukin 1 family, member 5 (delta)

Buy C15orf40-chromosome 15 open reading frame 40 Gene now

Add to cart