PDCD5-programmed cell death 5 Gene View larger

PDCD5-programmed cell death 5 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDCD5-programmed cell death 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PDCD5-programmed cell death 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015519
Product type: DNA & cDNA
Ncbi symbol: PDCD5
Origin species: Human
Product name: PDCD5-programmed cell death 5 Gene
Size: 2ug
Accessions: BC015519
Gene id: 9141
Gene description: programmed cell death 5
Synonyms: TFAR19; programmed cell death protein 5; TF-1 cell apoptosis-related protein 19; TF1 cell apoptosis-related gene 19; TFAR19 novel apoptosis-related
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacgaggagcttgaggcgctgaggagacagaggctggccgagctgcaggccaaacacggggatcctggtgatgcggcccaacaggaagcaaagcacagggaagcagaaatgagaaacagtatcttagcccaagttctggatcagtcggcccgggccaggttaagtaacttagcacttgtaaagcctgaaaaaactaaagcagtagagaattaccttatacagatggcaagatatggacaactaagtgagaaggtatcagaacaaggtttaatagaaatccttaaaaaagtaagccaacaaacagaaaagacaacaacagtgaaattcaacagaagaaaagtaatggactctgatgaagatgacgattattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutathione peroxidase 1
- ribosomal protein S27a
- LSM domain containing 1
- transmembrane protein 9

Buy PDCD5-programmed cell death 5 Gene now

Add to cart