Login to display prices
Login to display prices
TMEM9-transmembrane protein 9 Gene View larger

TMEM9-transmembrane protein 9 Gene

PTXBC001106

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM9-transmembrane protein 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM9-transmembrane protein 9 Gene

Proteogenix catalog: PTXBC001106
Ncbi symbol: TMEM9
Product name: TMEM9-transmembrane protein 9 Gene
Size: 2ug
Accessions: BC001106
Gene id: 252839
Gene description: transmembrane protein 9
Synonyms: DERM4; TMEM9A; transmembrane protein 9; dermal papilla-derived protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctcttatctttggtggctgtggtcgggtgtttgctggtgcccccagctgaagccaacaagagttctgaagatatccggtgcaaatgcatctgtccaccttatagaaacatcagtgggcacatttacaaccagaatgtatcccagaaggactgcaactgcctgcacgtggtggagcccatgccagtgcctggccatgacgtggaggcctactgcctgctgtgcgagtgcaggtacgaggagcgcagcaccaccaccatcaaggtcatcattgtcatctacctgtccgtggtgggtgccctgttgctctacatggccttcctgatgctggtggaccctctgatccgaaagccggatgcatacactgagcaactgcacaatgaggaggagaatgaggatgctcgctctatggcagcagctgctgcatccctcgggggaccccgagcaaacacagtcctggagcgtgtggaaggtgcccagcagcggtggaagctgcaggtgcaggagcagcggaagacagtcttcgatcggcacaagatgctcagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: