LSMD1-LSM domain containing 1 Gene View larger

LSMD1-LSM domain containing 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LSMD1-LSM domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LSMD1-LSM domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033861
Product type: DNA & cDNA
Ncbi symbol: LSMD1
Origin species: Human
Product name: LSMD1-LSM domain containing 1 Gene
Size: 2ug
Accessions: BC033861
Gene id: 84316
Gene description: LSM domain containing 1
Synonyms: LSMD1; PFAAP2; N-alpha-acetyltransferase 38, NatC auxiliary subunit; LSM domain containing 1; LSM domain-containing protein 1; phosphonoformate immuno-associated protein 2; N(alpha)-acetyltransferase 38, NatC auxiliary subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgttgcagtcggcgtcagagcagctccagtgctggggttagcacgggctctggttctgggactgaggggcagtcaagcagcaagatggagggggtggggaactgcagctcccggcagcctctgggctttgtgtgagtgccccgcgggctgccgggagctgtggttccgcgggcgggcagcctgggctgcgcggtctgagcgcttgttacaccccgcgcaggattcggacggagagcgcgaggactcggcggctgagcgcgcccgacagcagctagaggcgctgctcaacaagactatgcgcattcgcatgacagatggacggacactggtcggctgcttcctctgcactgaccgtgactgcaatgtcatcctgggctcggcgcaggagttcctcaagccgtcggattccttctctgccggggagccccgtgtgctgggcctggccatggtacccggacaccacatcgtttccattgaggtgcagagggagagtctgaccgggcctccgtatctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 9
- ribosomal protein L13a
- cysteine-rich protein 2
- MLX interacting protein

Buy LSMD1-LSM domain containing 1 Gene now

Add to cart