RPS27A-ribosomal protein S27a Gene View larger

RPS27A-ribosomal protein S27a Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS27A-ribosomal protein S27a Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPS27A-ribosomal protein S27a Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001392
Product type: DNA & cDNA
Ncbi symbol: RPS27A
Origin species: Human
Product name: RPS27A-ribosomal protein S27a Gene
Size: 2ug
Accessions: BC001392
Gene id: 6233
Gene description: ribosomal protein S27a
Synonyms: CEP80; HEL112; S27A; UBA80; UBC; UBCEP1; UBCEP80; ubiquitin-40S ribosomal protein S27a; 40S ribosomal protein S27a; epididymis luminal protein 112; ubiquitin C; ubiquitin and ribosomal protein S27a; ubiquitin carboxyl extension protein 80; ubiquitin-CEP80; ribosomal protein S27a
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagattttcgtgaaaacccttacggggaagaccatcaccctcgaggttgaaccctcggatacgatagaaaatgtaaaggccaagatccaggataaggaaggaattcctcctgatcagcagagactgatctttgctggcaagcagctggaagatggacgtactttgtctgactacaatattcaaaaggagtctactcttcatcttgtgttgagacttcgtggtggtgctaagaaaaggaagaagaagtcttacaccactcccaagaagaataagcacaagagaaagaaggttaagctggctgtcctgaaatattataaggtggatgagaatggcaaaattagtcgccttcgtcgagagtgcccttctgatgaatgtggtgctggggtgtttatggcaagtcactttgacagacattattgtggcaaatgttgtctgacttactgtttcaacaaaccagaagacaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LSM domain containing 1
- transmembrane protein 9
- ribosomal protein L13a
- cysteine-rich protein 2

Buy RPS27A-ribosomal protein S27a Gene now

Add to cart