GLRX2-glutaredoxin 2 Gene View larger

GLRX2-glutaredoxin 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GLRX2-glutaredoxin 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GLRX2-glutaredoxin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028113
Product type: DNA & cDNA
Ncbi symbol: GLRX2
Origin species: Human
Product name: GLRX2-glutaredoxin 2 Gene
Size: 2ug
Accessions: BC028113
Gene id: 51022
Gene description: glutaredoxin 2
Synonyms: CGI-133; GRX2; glutaredoxin 2; bA101E13.1 (GRX2 glutaredoxin (thioltransferase) 2); glutaredoxin (thioltransferase) 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagcaatacatcatcatctttggagaatttagcgacggcgcctgtgaaccagatccaagaaacaatttctgataattgtgtggtgattttctcaaaaacatcctgttcttactgtacaatggcaaaaaagcttttccatgacatgaatgttaactataaagtggtggaactggacctgcttgaatatggaaaccagttccaagatgctctttacaaaatgactggtgaaagaactgttccaagaatatttgtcaatggtacttttattggaggtgcaactgacactcataggcttcacaaagaaggaaaattgctcccactagttcatcagtgttatttaaaaaaaagtaagaggaaagaatttcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD247 molecule
- glutaredoxin 3
- visinin-like 1
- tetraspanin 3

Buy GLRX2-glutaredoxin 2 Gene now

Add to cart