CD247-CD247 molecule Gene View larger

CD247-CD247 molecule Gene

PTXBC025703

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD247-CD247 molecule Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD247-CD247 molecule Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025703
Product type: DNA & cDNA
Ncbi symbol: CD247
Origin species: Human
Product name: CD247-CD247 molecule Gene
Size: 2ug
Accessions: BC025703
Gene id: 919
Gene description: CD247 molecule
Synonyms: CD247 molecule; CD247 antigen, zeta subunit; CD3-ZETA; CD3H; CD3Q; CD3Z; IMD25; T3Z; TCRZ; T-cell surface glycoprotein CD3 zeta chain; CD3Z antigen, zeta polypeptide (TiT3 complex); CD3zeta chain; T-cell antigen receptor complex, zeta subunit of CD3; T-cell receptor T3 zeta chain; TCR zeta chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtggaaggcgcttttcaccgcggccatcctgcaggcacagttgccgattacagaggcacagagctttggcctgctggatcccaaactctgctacctgctggatggaatcctcttcatctatggtgtcattctcactgccttgttcctgagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgcagagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutaredoxin 3
- visinin-like 1
- tetraspanin 3
- sorting nexin 6

Buy CD247-CD247 molecule Gene now

Add to cart