VSNL1-visinin-like 1 Gene View larger

VSNL1-visinin-like 1 Gene

PTXBC022012

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VSNL1-visinin-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VSNL1-visinin-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022012
Product type: DNA & cDNA
Ncbi symbol: VSNL1
Origin species: Human
Product name: VSNL1-visinin-like 1 Gene
Size: 2ug
Accessions: BC022012
Gene id: 7447
Gene description: visinin-like 1
Synonyms: HLP3; HPCAL3; HUVISL1; VILIP-1; visinin-like protein 1; VLP-1; hippocalcin-like protein 3; visinin like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaagcagaatagcaaactggcccctgaagtgatggaggacctggtgaagagcacagagtttaatgagcatgaactcaagcagtggtacaaaggatttctcaaggactgtccaagtgggaggctaaatctcgaggaatttcagcagctctatgtgaagttctttccttatggagacgcctccaagtttgcccagcatgccttccgaaccttcgacaagaatggggacggcaccattgacttccgagagttcatctgcgctctgtccatcacctccaggggcagctttgagcagaagctgaactgggccttcaatatgtatgacctggatggtgatggcaagatcacccgagtggagatgctggagatcatcgaggctatctacaaaatggtaggcactgtgatcatgatgaaaatgaatgaggatggcctgacgcctgagcagcgagtagacaagattttcagcaagatggataagaacaaagatgaccagattacactggatgaattcaaagaagctgcaaagagcgacccttccattgtattacttctgcagtgcgacatccagaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetraspanin 3
- sorting nexin 6
- sideroflexin 2
- sorting nexin 7

Buy VSNL1-visinin-like 1 Gene now

Add to cart